13 the peritoneum as a first line of defense against carcinomatosis

Báo cáo y học: "Assessing the psychometric properties and the perceived usefulness of the BasisRaadsOnderzoek (BARO) as a first-line screening instrument for juvenile offenders" ppt

Báo cáo y học: "Assessing the psychometric properties and the perceived usefulness of the BasisRaadsOnderzoek (BARO) as a first-line screening instrument for juvenile offenders" ppt

Ngày tải lên : 13/08/2014, 18:22
... development of the BARO, a standardized screening instrument was not available for CPB workers, resulting in a vast qualitative and quantitative variety of reports As a result, it was not clear why ... the participants that underwent the global screening by means of the BARO as well as the elaborate forensic diagnostic assessment The concurrent validity was based on the correlation of the BARO ... discriminatory value And finally, the CPB workers evaluated the BARO as a useful and practicable instrument The BARO allows the formulation of well-founded advice Internal consistency analysis has...
  • 7
  • 382
  • 0
Báo cáo khoa học: "Combination therapy with docetaxel and S-1 as a first-line treatment in patients with advanced or recurrent gastric cancer: a retrospective analysis" docx

Báo cáo khoa học: "Combination therapy with docetaxel and S-1 as a first-line treatment in patients with advanced or recurrent gastric cancer: a retrospective analysis" docx

Ngày tải lên : 09/08/2014, 03:21
... A, Akiya T, Takagi M, Miyashita K, Nishizaki T, Kobayashi O, Takiyama W, Toh Y, Nagaie T, Takagi S, Yamamura Y, Yanaoka K, Orita H, Takeuchi M: S-1 plus cisplatin versus S-1 alone for first- line ... study of docetaxel, oxaliplatin, and S-1 for patients with advanced gastric cancer Cancer Chemother Pharmacol 2009, 64:877-883 Yoshida K, Hirabayashi N, Takiyama W, Ninomiya M, Takakura N, Sakamoto ... Hirabayashi N, Takiyama W, Sato Y, Todo S, Terashima M, Gotoh M, Sakamoto J, Nishiyama M: Phase II study of docetaxel and S-1 combination therapy for advanced or recurrent gastric cancer Clin Cancer...
  • 7
  • 407
  • 0
Báo cáo khoa học: "Spontaneous pneumothorax as a first sign of pulmonary carcinoma" pdf

Báo cáo khoa học: "Spontaneous pneumothorax as a first sign of pulmonary carcinoma" pdf

Ngày tải lên : 09/08/2014, 04:21
... 104(1):160-163 Minami H, Sakai S, Watanabe A, Shimokata K: Check-valve mechanism as a cause of bilateral spontaneous pneumothorax complicating bronchioloalveolar cell carcinoma Chest 1991, 100(3):853-855 ... primary lung cancer J Thorac Cardiovasc Surg 2002, 50(3):133-136 Nishioka M, Fukuoka M, Nakagawa K, Matsui K, Nakajima T: Spontaneous pneumothorax following partial resolution of total bronchial ... Tsukamoto T, Satoh T, Yamada K, Nagasawa M: Primary lung cancer presenting as spontaneous pneumothorax Nihon Kyobu Shikkan Gakkai Zasshi 1995, 33(9):936-939 Yeung KY, Bonnet JD: Bronchogenic carcinoma...
  • 3
  • 407
  • 0
Báo cáo y học: "Menstruating from the umbilicus as a rare case of primary umbilical endometriosis: a case report" pot

Báo cáo y học: "Menstruating from the umbilicus as a rare case of primary umbilical endometriosis: a case report" pot

Ngày tải lên : 11/08/2014, 14:21
... MRI also has an advantage over laparoscopy for evaluating pelvic and extraperitoneal diseases, as well as lesions concealed by adhesions excision and was involved in editing the manuscript All authors ... presence of endometriotic glands with mucinous type metaplasia and extravasation of the mucinous secretion into the adjacent stroma (Figure 1) No epithelial atypia was seen and the excision appeared ... extravasation of the mucinous Umbilical endometriosis: endometriotic glands with metaplasia of the mucinous type and extravasation of the mucinous secretion into the adjacent stroma Majority of...
  • 3
  • 383
  • 0
Báo cáo y học: " Self-reported sickness absence as a risk marker of future disability pension. Prospective findings from the DWECS/DREAM study 1990-2004"

Báo cáo y học: " Self-reported sickness absence as a risk marker of future disability pension. Prospective findings from the DWECS/DREAM study 1990-2004"

Ngày tải lên : 26/10/2012, 10:03
... Cochran-Armitage trend test was performed in order to test if a gradual increase in sickness absence was associated with increase in risk of disability pension The SAS procedure PROC GENMOD (SAS ... was stronger among men (OR=3.13) than among women (OR=2.19) (Table 2) Additional analysis treating days of sickness absence during 1990 as a continuous variable showed a clear trend of increase ... baseline DWECS questionnaire and disability pension data derived from DREAM among the 4177 persons categorized as 18-45 year old employees at baseline Outcome A disability pension case was defined...
  • 6
  • 578
  • 0
Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc

Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc

Ngày tải lên : 05/03/2014, 15:20
... anesthesia workload and that a typical epidural takes about half the time of a typical cesarean Accordingly, the OAAI for each hospital was calculated as ((0.75 * number of epidurals per year) + (1.5 ... (1) The ratio of the epidural and cesarean components of the OAAI (OAAI EPI and OAAI CD) was also calculated as follows: OAAICD/EPI = ( no of cesareans per yr *1.5 ) / ( no of epidurals per yr ... Obstetric anesthesia workload demand in Israel has increased due to both an increase in the requests for labor analgesia and a marked increase in the cesarean delivery rate We propose a new workload-driven...
  • 14
  • 610
  • 0
Smoking and reproduction: The oviduct as a target of cigarette smoke ppt

Smoking and reproduction: The oviduct as a target of cigarette smoke ppt

Ngày tải lên : 05/03/2014, 17:20
... oviduct: a regulator of local contraction and gamete transport J Cardiovasc Pharmacol 2004, 44 Suppl 1:S248-51 111 Wijayagunawardane MP, Miyamoto A, Taquahashi Y, Acosta TJ, Nishimura M, Sato K: Angiotensin ... beat frequency assay Many of the compounds in Table were also screened using a chick chorioallantoic membrane (CAM) assay that measures growth of the CAM and chick embryo [188,189] In the CAM assay, ... screen (Table 1) were previously thought to be safe and are included on the FEMA GRAS list (Flavor and Extract Manufacturers' Association – Generally Regarded As Safe) and the FDA EAFUS list...
  • 17
  • 733
  • 0
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx

Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx

Ngày tải lên : 06/03/2014, 01:20
... 5¢-GCAGCAUCUUUAAUGAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ ... (5¢-GATCTCCTCTTCAGCTA CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIII sites of pEGFP-NLS ... localization of HDAC4 orchestrates muscle differentiation Nucleic Acids Res 29, 3439–3447 22 Yasuhara N, Shibazaki N, Tanaka S, Nagai M, Kamikawa Y, Oe S, Asally M, Kamachi Y, Kondoh H & Yoneda...
  • 12
  • 454
  • 0
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

Ngày tải lên : 07/03/2014, 15:20
... 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT TGTCC-3¢; Site-2 mut, 5¢-GCGTCTCACCCTAGTAA TGGTAATGCTCCAAGGGTTTTTGTCC-3¢; ... gene and lg of control luciferase plasmid DNA (pGL3, Promega) were used for transfection CAT and luciferase activities were measured as described [17] DNase I protection assay Rat liver and HeLa ... carried out as described by Luciakova et al [13] MALDITOF analysis was performed in reflector mode using a Voyager-DE STR MALDI-TOF mass spectrometer (Applied Biosystems) Internal calibration was performed...
  • 8
  • 426
  • 0
Strengthening the Education Sector Response to School Health, Nutrition and HIV/AIDS in the Caribbean Region: A Rapid Survey of 13 Countries pdf

Strengthening the Education Sector Response to School Health, Nutrition and HIV/AIDS in the Caribbean Region: A Rapid Survey of 13 Countries pdf

Ngày tải lên : 14/03/2014, 20:20
... implementation In Trinidad and Tobago, the strategy recently expired The Bahamas, St Lucia, and St Vincent and the Anguilla Antigua The Bahamas Barbados Belize Dominica Grenada Guyana Jamaica St ... countries, namely the Bahamas, Barbados, Grenada, Guyana, Jamaica and Trinidad and Tobago, support is given to a Sector Wide Approach (SWAP) in education with one national sectoral plan including all ... teachers and other education employees Anguilla Antigua The Bahamas Barbados Belize Dominica Grenada Guyana Jamaica St Kitts & Nevis St Lucia St Vincent & Grenadines Trinidad & Tobago Table Health...
  • 40
  • 450
  • 0
Searching for a Mate: The Rise of the Internet as a Social Intermediary potx

Searching for a Mate: The Rise of the Internet as a Social Intermediary potx

Ngày tải lên : 15/03/2014, 21:20
... women of a certain age a reasonable measure of the lack of availability of partners for single men of the same age group (and vice-versa)? Despite the existence of age discrepant couples, age homophily ... through almost all of the traditional ways has fallen Family of origin and primary and secondary school (the “traditional” institutions based around place of origin) had already declined in importance ... the ACS) The higher rate of interraciality in HCMST is mainly due to the fact that the HCMST survey was offered only in English, whereas the ACS was offered in a variety of languages Asians and...
  • 50
  • 470
  • 0
Báo cáo khoa học: Identification of mitogen-activated protein⁄extracellular signal-responsive kinase kinase 2 as a novel partner of the scaffolding protein human homolog of disc-large docx

Báo cáo khoa học: Identification of mitogen-activated protein⁄extracellular signal-responsive kinase kinase 2 as a novel partner of the scaffolding protein human homolog of disc-large docx

Ngày tải lên : 22/03/2014, 16:20
... mutagenic primers were: GRRF-PDZ1: 5¢GAAAGGGGAAATTCAGGGCGTCGT TTCAGCATTGCAGGAGG-3¢; GRRF-PDZ2: 5¢-ATTA AAGGTCCTAAAGGTCGTCGGTTTAGCATTGCTGGA GG-3¢; RAAV-MEK2: 5¢-CACCCACGCGCGCCGCCGT GTGA-3¢ and ... RT-PCR using PlatiniumÒ Taq DNA High Fidelity Polymerase (Invitrogen) and the primers: PDZ-1-2, forward: 5¢-CCGAATTCGAAGAAATCACACTTGAAAGG-3¢, and reverse: 5¢GGATCCCCATCATTCATATACATACTTGT GGGTT-3¢; ... 5¢-GTGGGGAAATATGCTCTTGAGGAGGT-3¢; primers 2, forward: 5¢-GTGACTTCAGAGACACTGCCA-3¢, and reverse: 5¢-CCCTTTCAAGTGTGATTTCTTC3¢; primers 3, forward: 5¢-ACCAGATGGTGAGAGCGAT-3¢, and reverse: 5¢-CTGTCTTTCATAGGTCCCAAT-3¢...
  • 11
  • 419
  • 0
A Portrait of the Artist as a Young Man ppt

A Portrait of the Artist as a Young Man ppt

Ngày tải lên : 31/03/2014, 14:20
... face and the voice went away Sorry because he was afraid Afraid that it was some disease Canker was a disease of plants and cancer one of animals: or another different That was a long time ago ... prefect was there again and it was his voice that was saying that he was to get up, that Father Minister had said 22 A Portrait of the Artist as a Young Man he was to get up and dress and go to ... face was pale and strange and he wore the white cloak of a marshal O how cold and strange it was to think of that! All the dark was cold and strange There were pale strange faces there, great...
  • 317
  • 342
  • 0
Báo cáo hóa học: " A DISCRETE FIXED POINT THEOREM OF EILENBERG AS A PARTICULAR CASE OF THE CONTRACTION PRINCIPLE" pptx

Báo cáo hóa học: " A DISCRETE FIXED POINT THEOREM OF EILENBERG AS A PARTICULAR CASE OF THE CONTRACTION PRINCIPLE" pptx

Ngày tải lên : 23/06/2014, 00:20
... there is also a variant of the BCP for self-maps of a non-Archimedean metric space proved by Prieß-Crampe [10] (also see Petalas and Vidalis [9]) It turns out that, in general, the contraction ... able to obtain only some particular cases of the contraction principle via a discrete argument Finally, we discuss a variant of ET given by Rus [11] (cf Remarks 2.1 and 4.3) Proof of Eilenberg’s ... Polish Acad Sci Math 51 (2003), no 2, 147–156 C Petalas and T Vidalis, A fixed point theorem in non-Archimedean vector spaces, Proc Amer Math Soc 118 (1993), no 3, 819–821 S Prieß-Crampe, Der Banachsche...
  • 6
  • 268
  • 0
The Project Gutenberg E Book of The Argentine as a Market, by N. L. Watson potx

The Project Gutenberg E Book of The Argentine as a Market, by N. L. Watson potx

Ngày tải lên : 28/06/2014, 19:20
... rise as, in all probability they will, a rise in wages will be imperative This, in the case of railways would mean an increase in rates, as there are few who are earning more than a reasonable ... commercial development there is certain of an unfavourable reception But as sand and mud are the only base from Santa Fé to Bahia Blanca—in some cases there being not even firm sand—and as dredging ... goods as “ponchos” has lapsed in favour of German and Italian wares While the manufacture of matches—in the hands of a powerful monopoly, bolstered up by privileges and an exorbitant duty— was so...
  • 199
  • 354
  • 0
Báo cáo lâm nghiệp: "Frost damage on the terminal shoot as a risk factor of fork incidence on common beech (Fagus sylvatica L.)" docx

Báo cáo lâm nghiệp: "Frost damage on the terminal shoot as a risk factor of fork incidence on common beech (Fagus sylvatica L.)" docx

Ngày tải lên : 07/08/2014, 16:20
... an explanatory factor which was much significant than the other variables and factors available Thus overall, the damage factor had both a statistical and a causal value, i.e functional and more ... spite of the general impression of severe damage Conversely, this experimental method has the advantage of allowing one to bypass the frost itself in a way, as its characteristics are always difficult ... that an individual with a frost-nipped shoot was twice as likely to show a fork as an undamaged individual This value which was already high, should be considered to be a minimum value because...
  • 8
  • 348
  • 0
báo cáo khoa học: " Osteonecrosis of the jaw as a possible rare side effect of annual bisphosphonate administration for osteoporosis: A case report" ppsx

báo cáo khoa học: " Osteonecrosis of the jaw as a possible rare side effect of annual bisphosphonate administration for osteoporosis: A case report" ppsx

Ngày tải lên : 10/08/2014, 23:20
... Oral Maxillofac Surg 2003, 61(9):1115-1117 Advisory Task Force on Bisphosphonate-Related Osteonecrosis of the Jaws, American Association of Oral and Maxillofacial Surgeons: American Association ... http://www.jmedicalcasereports.com/content/5/1/477 Page of Figure a) intraoral examination of her left lower jaw with fistula formation and pus on palpation in region 38; b) panoramic radiograph with mixed radiopaque and radiolucent areas surrounding ... by mild to moderate pain on palpation A panoramic radiograph and cone beam computed tomography identified radiolucent areas at the resected apices of teeth 22 and 23 as well as the region surrounding...
  • 4
  • 233
  • 0
Báo cáo y học: "Dermoid cyst of the urinary bladder as a differential diagnosis of bladder calculus: a case report" pps

Báo cáo y học: "Dermoid cyst of the urinary bladder as a differential diagnosis of bladder calculus: a case report" pps

Ngày tải lên : 11/08/2014, 10:23
... Bladder teratoma: a case report and review of literature Indian J Cancer 1997, 34:20-21 Agrawal S, Khurana N, Mandhani A, Agrawal V, Jain M: Primary bladder dermoid: a case report and review of the ... the patient as well as the Figure Sweat glands, hyalinized fibroblastic tissue Sweat glands, hyalinized fibroblastic tissue Page of (page number not for citation purposes) Journal of Medical Case ... 85:796-799 Sabnis RB, Bradoo AM, Desai RM, Bhatt RM, Randive NU: Primary benign vesical teratoma A case report Arch Esp Urol 1993, 46:444-445 Misra S, Agarwal PK, Tandon RK, Wakhlu AK, Misra NC: Bladder...
  • 3
  • 231
  • 0
Báo cáo y học: " Involvement of the genicular branches in cystic adventitial disease of the popliteal artery as a possible marker of unfavourable early clinical outcome: a case report" pps

Báo cáo y học: " Involvement of the genicular branches in cystic adventitial disease of the popliteal artery as a possible marker of unfavourable early clinical outcome: a case report" pps

Ngày tải lên : 11/08/2014, 12:20
... this article as: Ypsilantis and Tisi: Involvement of the genicular branches in cystic adventitial disease of the popliteal artery as a possible marker of unfavourable early clinical outcome: a case ... Summary of cases of adventitial cystic disease of the popliteal artery Ann Surg 1979, 189:165-175 Cassar K, Engeset J: Cystic adventitial disease: a trap for the unwary Eur J Vasc Endovasc Surg ... DS, Arko FR: Cystic adventitial disease of the popliteal artery J Vasc Surg 2009, 49(5):1324 Crolla RM, Steyling JF, Hennipman A, Slootweg PJ, Taams A: A case of cystic adventitial disease of...
  • 4
  • 333
  • 0
Báo cáo y học: "Extramedullary plasmacytoma of the pancreas as an uncommon cause of obstructive jaundice: a case report" ppsx

Báo cáo y học: "Extramedullary plasmacytoma of the pancreas as an uncommon cause of obstructive jaundice: a case report" ppsx

Ngày tải lên : 11/08/2014, 14:20
... immediately following the diagnosis of the plasmacytoma of the pancreas The typical presentation of extramedullary plasmacytomas of the pancreas includes jaundice and abdominal pain, often related ... tenderness was elicited and a Courvoisier’s gall bladder palpated Digital rectal examination revealed altered blood, and nasogastric drainage revealed coffee-ground material A diagnosis of an upper gastrointestinal ... discrete, often solitary, mass of neoplastic plasma cells which may occupy medullary or soft tissue, that is, extramedullary, sites [3] Extramedullary plasmacytomas account for 5% of all plasma cell...
  • 4
  • 239
  • 0